View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7054_low_4 (Length: 255)
Name: NF7054_low_4
Description: NF7054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7054_low_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 26 - 255
Target Start/End: Original strand, 33306393 - 33306623
Alignment:
| Q |
26 |
ttcctttccttcaattcattgttc-atagttcatagcagtgtttctctcttttctattggatggagattcaatcctgtctttttatgaatcccctacagc |
124 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33306393 |
ttcctttccttcaattcattgttccatagttcatagcagtgtttctctcttttctattcaatggagattcaatcctatctttttatgaatcccctacagc |
33306492 |
T |
 |
| Q |
125 |
agtcagctgcatggtgcaacaactctatggtgtggcaaccgtgggaatcgttaaatctagtgagtgaaaaattctctatctaaatctaaattcaacattt |
224 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33306493 |
agtcagctgcatggtgcaacaactccatggtgtggcaaccgtgggaatcgttaaatctagtgagtgaaaaattctctatctaaatctaaattcaacattt |
33306592 |
T |
 |
| Q |
225 |
ttatgaagcataacaaccaacaacagtgttt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33306593 |
ttatgaagcataacaaccaacaacagtgttt |
33306623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University