View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7055_low_14 (Length: 272)
Name: NF7055_low_14
Description: NF7055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7055_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 37 - 183
Target Start/End: Original strand, 10921578 - 10921724
Alignment:
| Q |
37 |
ttttccatttttcactcttgaaaacttctaacgagtcatgccttctttcacacaaagtccttctccactttcatagtctctcagaaaaataggttgctgc |
136 |
Q |
| |
|
||||||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10921578 |
ttttccatttttcactcttcaaaatttctaatgagtcatgccttctttcacacaaagtccttctccactttcatagtctctcagaaaaataggttgctgc |
10921677 |
T |
|
| Q |
137 |
ctggttcttccatcgcgtgtttcttgtatttttctttgtgacagcac |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10921678 |
ctggttcttccatcgcgtgtttcttgtatttttctttgtgacagcac |
10921724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 43 - 145
Target Start/End: Original strand, 10950593 - 10950697
Alignment:
| Q |
43 |
atttttcactcttgaaaacttctaacgagtcatgc--cttctttcacacaaagtccttctccactttcatagtctctcagaaaaataggttgctgcctgg |
140 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
10950593 |
atttttcactcttctaaacttctaatgagtcatgcagcttctttcacacaaagtccttctccactttcatagtctctcacaaaagtaggttgctgcctgg |
10950692 |
T |
|
| Q |
141 |
ttctt |
145 |
Q |
| |
|
||||| |
|
|
| T |
10950693 |
ttctt |
10950697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 221 - 260
Target Start/End: Original strand, 10921762 - 10921801
Alignment:
| Q |
221 |
tatatctttaaaaatcttattgatgtgtatcttctatatt |
260 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10921762 |
tatatctttaaaaatcttattgatgcgtatcttctatatt |
10921801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University