View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7055_low_16 (Length: 249)
Name: NF7055_low_16
Description: NF7055
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7055_low_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 249
Target Start/End: Original strand, 30916971 - 30917199
Alignment:
| Q |
21 |
ttgtctgcttgtttaacctcatgcaaagtcatcactccagactacggatgacgaccttgggcgcaactattacaaactggatcaagacccataatcttca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30916971 |
ttgtctgcttgtttaacctcatgcaaagtcatcactccagactacggatgacgacctagggcgcaactattacaaactggatcaagacccataatcttcg |
30917070 |
T |
 |
| Q |
121 |
ttgtctaaggcctaatcacactgaagaacaaccttatactttcactactctgtaacgcctcaacgactagctctggatgcttaccattatgtaatgcctc |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30917071 |
ttgtgtaaggcctaatcacactgaagaacaaccttatactttcactactctgtaacgcctcaacgactagctctggatgcttaccattatgtaatgcctc |
30917170 |
T |
 |
| Q |
221 |
gacaacaagtaacagttttcggagctgaa |
249 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
30917171 |
gacaacaagtaacagttttcggggctgaa |
30917199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University