View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7056_high_7 (Length: 292)
Name: NF7056_high_7
Description: NF7056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7056_high_7 |
 | |
|
| [»] scaffold0699 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0699 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: scaffold0699
Description:
Target: scaffold0699; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 21 - 276
Target Start/End: Original strand, 5550 - 5805
Alignment:
| Q |
21 |
cactatattaaatgtcaacaccaagaactgatgtctgtctacaagaagaactgattctctgctttcagacatttgttgatactagctgttttgacttgca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
5550 |
cactatattaaatgtcaacaccaagaactgatgtctgtctacaagaagaactgattctctgctttcagacatttgttaatactagctgttttgatttgca |
5649 |
T |
|
| Q |
121 |
cataagactatttgttgatttatccatatttgtaaaacttgagggtatgaaaaatacgctagtagtttcaagcatgtgccccatcaaatgacaaaatgca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5650 |
cataagactatttgttgatttatccatatttgtaaaacttgagggtatgaaaaatacgctaggagtttcaaacatgtgccccatcaaatgacaaaatgca |
5749 |
T |
|
| Q |
221 |
tgaaaaacacaggagaaagttcaataatgcttcatagaaagatgagatgaaaaaga |
276 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750 |
tgaaaaacacaggagaaggttcaataatgcttcatagaaagatgagatgaaaaaga |
5805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0699; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 262
Target Start/End: Original strand, 511 - 589
Alignment:
| Q |
184 |
agtttcaagcatgtgccccatcaaatgacaaaatgcatgaaaaacacaggagaaagttcaataatgcttcatagaaaga |
262 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||| || |||||||| ||| ||||||||||||| ||||| |||||| |
|
|
| T |
511 |
agtttcaaacaggtgccccatcaaatgagaaaatgcttggaaaacacaagaggaagttcaataatgtttcatcgaaaga |
589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University