View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7059_high_3 (Length: 359)
Name: NF7059_high_3
Description: NF7059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7059_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 343
Target Start/End: Original strand, 43214982 - 43215306
Alignment:
| Q |
19 |
agtacaagaagccagtcatatgtcttggtggggtggggacactaactatatctcaggtggctgctgtttctaacagtacctcacatgttaaggttgaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43214982 |
agtacaagaagccagtcatatgtcttggtggggtggggacactaactatatctcaggtggctgctgtttctaacagtagctcacatgttaaggttgaact |
43215081 |
T |
 |
| Q |
119 |
ctcagagtctgcaagggccggtgttgcagctagctgtgactggatcgcggaaaacattgtcaaaggtactccaatttatggtgttaccactggctttggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43215082 |
ctcagagtctgcaagggccggtgttgaagctagctgcgactggatctccgaaaacattgtcaaaggtactccaatttatggtgttaccactggctttggt |
43215181 |
T |
 |
| Q |
219 |
gctgcctcacatagaagaactgaacaaggctttgctcttcagaaagagatggttaggtgaggttcaactctgaataatatttagccagtataggccatgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43215182 |
gctgcctcacatagaagaactgaacaaggctttgctcttcagaaagagatggttaggtgaggttcaactctgaataatatttagccagtataggccattt |
43215281 |
T |
 |
| Q |
319 |
ttatatatacaacttgattgagcac |
343 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
43215282 |
ttatatatacaacttaattgagcac |
43215306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University