View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7059_low_6 (Length: 262)
Name: NF7059_low_6
Description: NF7059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7059_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 21 - 252
Target Start/End: Complemental strand, 33986431 - 33986194
Alignment:
| Q |
21 |
ccagctccaacagcaactcctatactcaaaccaacattcatatttagcaattaggtattcacatctcatctatgatattaacggaaatgatcaacactac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33986431 |
ccagctccaacagcaactcctatactcaaaccaacattcatatttagcaattaggtattcacatctcatctatgatattaacggaaatgatcaacactac |
33986332 |
T |
 |
| Q |
121 |
atctatatgtgatttccaacttttatatgacgaatatataagatatatgtaactc------atatacctaatacctagagtaatggatggaacaaaacaa |
214 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33986331 |
atgtatatgtgatttccaacttttatatgacgaatatataagatatatgtaactcatattcatatacctaatacctagagtaatggatggaacaaaacaa |
33986232 |
T |
 |
| Q |
215 |
tatccataaatccattcaaaattcaaattctattcatc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33986231 |
tatccataaatccattcaaaattcaaattcgattcatc |
33986194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University