View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7059_low_9 (Length: 239)
Name: NF7059_low_9
Description: NF7059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7059_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 11827829 - 11827721
Alignment:
| Q |
18 |
ggtagtgtattcaattctaccataaatgttattgaaaatggaaaagaggagggagtagtacactagtattttctttattccttgcttcttatatttgcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11827829 |
ggtagtgtattcaattctaccataaatgttattgaaaatggaaaagaggagggagtagtacactagtattttctttattccttgcttcttatatttgcgt |
11827730 |
T |
 |
| Q |
118 |
tgcttcatg |
126 |
Q |
| |
|
||||||||| |
|
|
| T |
11827729 |
tgcttcatg |
11827721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 192 - 239
Target Start/End: Complemental strand, 11827655 - 11827608
Alignment:
| Q |
192 |
acgcaagcaaaatcaagccatttctgatcgtgatgagggacgtactgt |
239 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11827655 |
acgcaagcaaaatcaagccgtttctgatcgtgatgagggacgtactgt |
11827608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 65 - 126
Target Start/End: Original strand, 47344596 - 47344657
Alignment:
| Q |
65 |
ggagggagtagtacactagtattttctttattccttgcttcttatatttgcgttgcttcatg |
126 |
Q |
| |
|
||||||||| | |||||| |||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
47344596 |
ggagggagtgggacactaatattttctttattccttgcttcttgtatttgccatgcttcatg |
47344657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University