View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7060_high_12 (Length: 272)
Name: NF7060_high_12
Description: NF7060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7060_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 8840290 - 8840553
Alignment:
| Q |
1 |
gaaaaggttgatgcaaaacgaaaa---gtggcgtcagatcaacaggacgggcaatcagatcatcaggatcaaccagaagaattcgaaacgaattttcctg |
97 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8840290 |
gaaaaggttgatgcaaaacgaaaacaagtggtgtcggatcaacaggacgggcaatcagatcatcaggatcaaccagaagaattcgaaacgaattttcctg |
8840389 |
T |
 |
| Q |
98 |
gttatcctgatgaggcgattgtttgtatgagtaagattgtgggggagatgttgatcggaggatatgaaagtgagtgttgtcaggtgtacattgtggcgag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8840390 |
gttatcctgatgaggcgattgtttgtatgagcaagattgtgggggagatgttgatcggaggatatgaaagtgagtgttgtcaggtgtacattgtggcgag |
8840489 |
T |
 |
| Q |
198 |
aaggaccgcgttcgaggagattcaacagcagctggggctggaaagaatcagtattgatgatatt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8840490 |
aaggaccgcgttcgaggagattcaacagcagctggggctggaaagaatcagtattgatgatatt |
8840553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University