View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7060_high_14 (Length: 268)
Name: NF7060_high_14
Description: NF7060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7060_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 8840013 - 8839765
Alignment:
| Q |
1 |
attctcctccacctgatccaaaaacttctctatgtaaccaggaatctcaaacgacactccttctttctcatgaagaagaaaatgatcaatgtcttctgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8840013 |
attctcctccacctgatccaaaaacttctctatgtaaccaggaatctcaaacgacactccttctttctcatgcagaagaaaatgatcaatgtcttctgaa |
8839914 |
T |
|
| Q |
101 |
accttctcacagataggaggagacttcacagcctcaatggtttctgcatttccttccttcttctcttcctccatttgatgatcaacctcatttgacagcg |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8839913 |
accttctcacagatagggggagacttcacagcctcaatggtttctgcatttccttccttgttctcttcctccatttgatgatcaacctcatttgacagcg |
8839814 |
T |
|
| Q |
201 |
gaggcggtgatggtggttgctcttctccggtgtcggtgtgagttttagg |
249 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8839813 |
gaggcggtgatggtggttgctctcctccggtgtcggtgtgagttttagg |
8839765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 76 - 108
Target Start/End: Original strand, 10627062 - 10627094
Alignment:
| Q |
76 |
aagaaaatgatcaatgtcttctgaaaccttctc |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
10627062 |
aagaaattgatcaatgtcttctgaaaccttctc |
10627094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University