View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7060_high_16 (Length: 238)
Name: NF7060_high_16
Description: NF7060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7060_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 17 - 208
Target Start/End: Original strand, 4716865 - 4717076
Alignment:
| Q |
17 |
taaatttaatgtctttgtaatgcaagaagaaattttaaaataaaatcttatttttcaa--------------------aagcttgaaaatggaacccacg |
96 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4716865 |
taaatttaatgtctttgtagtgcaagaagaaatttgaaaataaaatcttatttttcaaagataataacccacaatcaaaagcttgaaaatggaacccacg |
4716964 |
T |
 |
| Q |
97 |
taaatgataacaaaacgtggtagtggtaatggcagaagaaaacgtgtcgtcatattgaaggataatgagaaagaagattttgaaaggaacgaggattaag |
196 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4716965 |
taaatgataacaaaacgtcgtagtggtaatggcagaagaaaacgtgtcgtcatattgaaggataatgagaaagaagattttgaaaggaacgaggattaag |
4717064 |
T |
 |
| Q |
197 |
gcacttgtagtt |
208 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4717065 |
gcacttgtagtt |
4717076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University