View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7060_high_19 (Length: 216)
Name: NF7060_high_19
Description: NF7060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7060_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 24059361 - 24059179
Alignment:
| Q |
20 |
aggtgtgttaataatgggttctggaagtgctgttcataatttgggaacacttaatcctcgtgcaggtgttgctccttgggcgttagaattcgataattgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24059361 |
aggtgtgttaataatgggttctggaagtgctgttcataatttgggaacacttaatcctcgtgcaggtgttgctccttgggcgttagaattcgataattgg |
24059262 |
T |
|
| Q |
120 |
ttgaaagatgctcttcttgatggaaggtttgtacccctttttctgttttgatgttcgagtttaaagattacatatgcgtgtgt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24059261 |
ttgaaagatgctcttcttgatggaaggtttgtacccctttttctgttttgatgttcgagtttaaagattacatatgcgtgtgt |
24059179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University