View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7060_low_16 (Length: 270)
Name: NF7060_low_16
Description: NF7060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7060_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 36 - 258
Target Start/End: Original strand, 49120466 - 49120688
Alignment:
| Q |
36 |
gttgcaacgggtatttcaacaggggttttattagtctttgcttactgaacaacagtcgaattgaattacattgtatgaagtttaatcatttattctttac |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49120466 |
gttgcaacgggtatttcaacaggggttttattagtctctgcttactgaacaacagtcgaattgaattacattgtatgaagtttaatcattcattctttac |
49120565 |
T |
 |
| Q |
136 |
attttttatcaacaatccaaaccctgttatcttctttgacggacccccaaaacagtcgaaattacagtgtgaaatttaattatttatcctttacatttgt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49120566 |
attttttatcaacaatccaaaccctgttatcttctttgacggacccccaaaacagtcgaaattacagtgtgaaatttaattatttatcctttacatttgt |
49120665 |
T |
 |
| Q |
236 |
tatcaacaattcaaccctcttct |
258 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49120666 |
tatcaacaattcaaccctcttct |
49120688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University