View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7060_low_23 (Length: 205)
Name: NF7060_low_23
Description: NF7060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7060_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 178
Target Start/End: Original strand, 475635 - 475794
Alignment:
| Q |
19 |
atgtagtccatgtcaaacagaagatagatccaaaatctatggttactcagacagaggaagtgaaaattttgataaccgatttgaaagaaactcttttagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
475635 |
atgtagtccatgtcaaacagaagatagatccaaaatctatggttactcagacagaggaagtgaaaattttgataaccgatttgaaagaaactcttttagc |
475734 |
T |
 |
| Q |
119 |
agatgaatctacattacaacgttgattgaaaaaggaatcaatgaatgtcattccataatt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
475735 |
agatgaatctacattacaacgttgattgaaaaaggaatcaatgaatgtcattccataatt |
475794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 449687 - 449745
Alignment:
| Q |
28 |
atgtcaaacagaagatagatccaaaatctatggttactcagacagaggaagtgaaaatt |
86 |
Q |
| |
|
|||| ||| ||||||||| ||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
449687 |
atgttaaagagaagatagttccaaaatctatggttaatgagacagaggaagtgaaaatt |
449745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University