View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7061_low_26 (Length: 271)

Name: NF7061_low_26
Description: NF7061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7061_low_26
NF7061_low_26
[»] chr5 (1 HSPs)
chr5 (8-128)||(39185319-39185439)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 8 - 128
Target Start/End: Complemental strand, 39185439 - 39185319
Alignment:
8 agaacctgtggtttgtgtttttgtttcagattcgttgttgtatcttcgaattcgagtttgggactcttaggattggggtttatatcgttctgttgggtct 107  Q
    |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||||||||||||    
39185439 agaacctgtgttttgtgtttttgtttcagattcgttgttgtatctttgaattcgagtttgggtctcttaggattggggtttctatcgttctgttgggtct 39185340  T
108 ctgagacttgctgctattgct 128  Q
    |||||||||||||||||||||    
39185339 ctgagacttgctgctattgct 39185319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University