View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7062_high_10 (Length: 309)
Name: NF7062_high_10
Description: NF7062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7062_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 30472007 - 30472172
Alignment:
| Q |
1 |
attgatcctaatatgtccaatttaattaccttcatccatccttaaatataaaacctccatccatcgatttgtggtttttgtggacggg-tttcgttcgag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30472007 |
attgatcctaatatgtccaatttaattaccttcatccatccttaaatataaaaccaccatccatcgatttgtggtttttgtggacgggttttcgttcgag |
30472106 |
T |
 |
| Q |
100 |
tagcagaagataagtgtttggatctcgtttggagatttgcaatggtggttgaagatttggctcaca |
165 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472107 |
tagtggaagataagtgtttggatctcgtttggagatttgcaatggtggttgaagatttggctcaca |
30472172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 297
Target Start/End: Original strand, 30472270 - 30472304
Alignment:
| Q |
263 |
agttgagtgatatttttgtcagtgatttgatgtcc |
297 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
30472270 |
agttgagtgatatttttgtcggtgatttgatgtcc |
30472304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University