View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7062_high_11 (Length: 300)
Name: NF7062_high_11
Description: NF7062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7062_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 38612578 - 38612280
Alignment:
| Q |
1 |
tgaaaacaacctatgcctcctccatgggttctggttcaggttcaggttcaggttccggcgctggtgcttgcgcttg------agcttcaacgtcgcctcc |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38612578 |
tgaaaacaacctatgcctcctccatgggttctggttctggttcaggttcaggttccggcgctggtgcttgcgcttgcgcttgagcttcaacgtcgcctcc |
38612479 |
T |
|
| Q |
95 |
agactttcggaagatctgatcgatgcggcgagtaccaaccggaacggatttaggccgatccacaaccgccgctggtttatcagatttcacagtttcagac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612478 |
agactttcggaagatctgatcgatgcggcgagtaccaaccgaaacggatttaggccgatccacaaccgccgctggtttatcagatttcacagtttcagac |
38612379 |
T |
|
| Q |
195 |
ggcaccggaagcgaatcgagtagaaaatcacttattggacggtttctcttcaccgcgattctcatatgttcaagcttcaccgtcttgcgcttcttctca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38612378 |
ggcaccggaagcgaatcgagtagaaaatcacttattggacggtttctcttcaccgcgattctcatatgttcaagcttcaccgtcttgcgcttcttctca |
38612280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University