View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7062_high_5 (Length: 424)
Name: NF7062_high_5
Description: NF7062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7062_high_5 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 5 - 420
Target Start/End: Original strand, 436744 - 437159
Alignment:
| Q |
5 |
agacaacggatgcaaagaagcttgtgatgagaaaatcatccacgaggaccttggaacgacggaaaaaaccttcttccctattgatacacacaatacaaat |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
436744 |
agacaaaggatgcaaagaagcttgtgatgagaaaatcatccacgaggaccttggaacgacggaaaaaaccttcttccctattgatacgcacaatacaaat |
436843 |
T |
|
| Q |
105 |
gactcacgattggtgctggatagcatgtcactgaaagggcctcactggagcggtgaccaatttgaagttgggattccacgtctcgagcttgcgttgggag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436844 |
gactcacgattggtgctggatagcatgtcactgaaagggcctcactggagcggtgaccaatttgaagttgggattccacgtctcgagcttgcgttgggag |
436943 |
T |
|
| Q |
205 |
gtgaaatggaacagtcactggagggtacgcgttctttctttgctgggatagctgataagaaaagtaaccaggaaaagactccagattgtttggaagctga |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436944 |
gtgaaatggaacagtcactggagggtacgcgtcctttctttgctgggatagctgataagaaaagtaaccaggaaaagactccagattgtttggaagctga |
437043 |
T |
|
| Q |
305 |
gcaagaggatggcgacagtgttgccgcatctctttccctgtctctatctttcccatcttcaaacaaggaacccacaaaacatgcttcaaaagatgagcat |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
437044 |
gcaagaggatggcgacagtgttgccgcatctctttccctgtctctatctttcccatcttcaaacaaggaacccacaaaacatgcttcaaaagatgagcat |
437143 |
T |
|
| Q |
405 |
ttgcctgatgtccatc |
420 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
437144 |
ttgcctgatgtgcatc |
437159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University