View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7062_high_9 (Length: 310)
Name: NF7062_high_9
Description: NF7062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7062_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 20 - 295
Target Start/End: Original strand, 53501614 - 53501890
Alignment:
| Q |
20 |
tatcactccctactactatcaactttcaaacacttcattatagagatggtttcttcaaatgatttcaacatgttaattctaattcctcttcttgttagct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53501614 |
tatcactccctactactatcaactttcaaacacttcattatagagatggtttcttcaaatgatttcaacatgttaattctaattcctcttcttgttagct |
53501713 |
T |
 |
| Q |
120 |
ccctaatggtaatgaatgcctttgctgctggtaacttgaaccaacactttgatataacatggggagatggccgagcgaagatactaaacaatggtgagtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53501714 |
ccctaatggtaatgaatgcctttgctgctggtaacttgaaccaacactttgatataacatggggagatggccgagcgaagatactaaacaatggtgagtt |
53501813 |
T |
 |
| Q |
220 |
actcactctatcacttgacaaagcatctggttcaggattccaatcaaagaatgagtatctc-tttgggaagattgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53501814 |
actcactctatcacttgacaaagcatctggttcaggattccaatcaaagaatgagtatctcttttgggaagattgat |
53501890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 165 - 295
Target Start/End: Original strand, 53494651 - 53494781
Alignment:
| Q |
165 |
actttgatataacatggggagatggccgagcgaagatactaaacaatggtgagttactcactctatcacttgacaaagcatctggttcaggattccaatc |
264 |
Q |
| |
|
||||||||||||||||||||||||| || || |||||||| |||| || | | |||||| |||| ||||||||||| |||||||| ||||| ||||| |
|
|
| T |
53494651 |
actttgatataacatggggagatggtcgtgccaagatactcgacaacggacaacttctcactttatcccttgacaaagcctctggttctggatttcaatc |
53494750 |
T |
 |
| Q |
265 |
aaagaatgagtatctctttgggaagattgat |
295 |
Q |
| |
|
|||||||| ||||||||||| || |||||| |
|
|
| T |
53494751 |
caagaatgaatatctctttggcaacattgat |
53494781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University