View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7062_low_12 (Length: 358)
Name: NF7062_low_12
Description: NF7062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7062_low_12 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Complemental strand, 436742 - 436398
Alignment:
| Q |
1 |
caactcaagatgccgaaccaaaatcgtttacaagtgatgcagaacttccattcaaagaatccctagctacagaactgtaacatccatagattccactgaa |
100 |
Q |
| |
|
||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436742 |
caactgaatatgcggaaccaaaatcgtttacaagtgatgcagaacttccattcaaagaatccctagctacagaactgtaacatccatagattccactgaa |
436643 |
T |
 |
| Q |
101 |
acctgactgcagcttactagaactgtctgtatcttccaacttcccatctatcttattccgaggcatttcctgacagccagctgcagaagcgtccataact |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436642 |
acctgactgcagcttgctagaactgtctgtatcttccaacttcccatctatcttattccgaggcatttcctgacagccagctgcagaagcgtccataact |
436543 |
T |
 |
| Q |
201 |
gtgtcagaatggtctatatgctcaacttttataacattaggtagccgacagctgaccgcttctatggccagatctccctgaaaagttgcttctacattaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436542 |
gtgtcagaatggtctatatgctcaacttttataacattaggtagccgacagctgaccgcttctatggccagatctccctgaaaagttgcttctacattaa |
436443 |
T |
 |
| Q |
301 |
tattgagaccatcttctctctctttccttttaggccttcgatgat |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
436442 |
tattgagaccatcttctctctctttccttttaggccttcgatgat |
436398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University