View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7062_low_2 (Length: 920)

Name: NF7062_low_2
Description: NF7062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7062_low_2
NF7062_low_2
[»] chr4 (1 HSPs)
chr4 (153-323)||(28447982-28448152)
[»] chr3 (1 HSPs)
chr3 (477-580)||(16060150-16060253)
[»] chr8 (1 HSPs)
chr8 (778-903)||(2625175-2625298)
[»] chr7 (1 HSPs)
chr7 (630-741)||(31772790-31772896)
[»] chr2 (1 HSPs)
chr2 (156-233)||(18690607-18690684)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 1e-86
Query Start/End: Original strand, 153 - 323
Target Start/End: Original strand, 28447982 - 28448152
Alignment:
153 tttgggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaatcttttgttggagtggttgt 252  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28447982 tttgggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaatcttttgttggagtggttgt 28448081  T
253 ctatttctataggcgtcaggcctacagacctcccctctacatcgatgatgatggatgctagtggggccggg 323  Q
    |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
28448082 ctatttctataggcatcagacctacagacctcccctctacatcgatgatgatggatgctagtggggccggg 28448152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 96; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 477 - 580
Target Start/End: Original strand, 16060150 - 16060253
Alignment:
477 ctatctttagggacttggaacagcccggaggagagcccgcacctcaaccagaggctgcgcagcctgggcaagttccagaagggccactgggggaagtctt 576  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||    
16060150 ctatctttagggacttggaacagcccggaggagagcccgcacctcaaccagaggctgcgcagcatgggcaagttccagaagggccactaggggaagtctt 16060249  T
577 tgag 580  Q
    ||||    
16060250 tgag 16060253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 95; Significance: 5e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 5e-46
Query Start/End: Original strand, 778 - 903
Target Start/End: Original strand, 2625175 - 2625298
Alignment:
778 gtgggaatatcggccagagactcttacaaaccgactcgcccagttggatagagaggggaccaaatctcccttttccgggaacttctcgcattgcgcgaag 877  Q
    ||||||||||||| ||||||||||||||||||||||| |||||||||||||||  |||||| ||||| |||||||||||||||||| |||||||||||||    
2625175 gtgggaatatcggacagagactcttacaaaccgactcacccagttggatagag--gggaccgaatctgccttttccgggaacttcttgcattgcgcgaag 2625272  T
878 aatatccacaaaactgaccccctgat 903  Q
    ||||||||||||||||||||||||||    
2625273 aatatccacaaaactgaccccctgat 2625298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 2e-27
Query Start/End: Original strand, 630 - 741
Target Start/End: Original strand, 31772790 - 31772896
Alignment:
630 agccccccatagatgatattctaactttgattaacctcaaaagtcaggttatattatatctcggatggccgagctggacccagaccctttctgggttgaa 729  Q
    |||||||||||||||| ||| |||||||||||||||||||||||||||     ||||||||| ||||| |||||||||||| |||||||||| |||||||    
31772790 agccccccatagatgaaattataactttgattaacctcaaaagtcagg-----ttatatctcagatgggcgagctggaccccgaccctttctaggttgaa 31772884  T
730 aaccgaaccagc 741  Q
    ||||||| ||||    
31772885 aaccgaatcagc 31772896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 156 - 233
Target Start/End: Original strand, 18690607 - 18690684
Alignment:
156 gggctttggctggccttggcttcggtgttcctctctctggggttcctattttgtgcgttggaagttacggccttcaat 233  Q
    ||||||||| ||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||||  ||||||||    
18690607 gggctttggttggccttggcttcggtgttcctctctctgaggttcctagtttttgcgttggaagttacaaccttcaat 18690684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University