View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7062_low_5 (Length: 450)
Name: NF7062_low_5
Description: NF7062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7062_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-125; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 13 - 280
Target Start/End: Complemental strand, 9868088 - 9867821
Alignment:
| Q |
13 |
tcgaagaatataccacacacatcaaaccctatccttaattcaacatacaaaaattgctttggaacattggtgaaatataaagaagcgacgccagtctctc |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9868088 |
tcgaacaatataccacacacatcaaaccctttccttaattcaacatacaaaaattgctttggaacattggtgaaatataaggaagcgacgccagtctctc |
9867989 |
T |
|
| Q |
113 |
tttgatcatgatttcgtcatgcatcgtgaatatgatgattgagtcatatttgtttagccatgcatgactaaattccacgtgaataaaacttttctagaca |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9867988 |
tttgatcatgatttcgccatgcatcgtgaatatgatgattgaatcatatttgtttagccatgcatgactaaattccacgttaataaaacttttctagatg |
9867889 |
T |
|
| Q |
213 |
gtgtgatccaattaccactaagatcgctactaaaggcaaaccacaatcgactagtcttttgcgaatgt |
280 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9867888 |
gtgtgatccaattaccactacgatcgctactaaaggcaaaccacagtcgactagtcttttgcgaatgt |
9867821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 277 - 377
Target Start/End: Complemental strand, 9867765 - 9867665
Alignment:
| Q |
277 |
atgttgaagtcttcaaccctttgattactgttgattctcccccttgccgcgagaaactctgaaacttggcatgtcgtcgatcatcctcccatgacccata |
376 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9867765 |
atgttgaagtcttcaaccctttgatgactattgattctcccccttgccgcgagaaactctgaaacttggcatgtcctcgatcatcctcccatgacccata |
9867666 |
T |
|
| Q |
377 |
t |
377 |
Q |
| |
|
| |
|
|
| T |
9867665 |
t |
9867665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 409 - 438
Target Start/End: Complemental strand, 9867635 - 9867606
Alignment:
| Q |
409 |
ttagtggaacccttccgctcccatgatgtc |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9867635 |
ttagtggaacccttccgctcccatgatgtc |
9867606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University