View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7064_high_11 (Length: 220)
Name: NF7064_high_11
Description: NF7064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7064_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 55 - 204
Target Start/End: Original strand, 23178169 - 23178318
Alignment:
| Q |
55 |
acaaatatcatttctctaatatatgttgatttttgttgaatttaatgacagcctgttttggaagccaaaatcaccgtagtgaggcttgataaaaactatc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23178169 |
acaaatatcatttctctaatatatgttgatttttgttgaatttaatgacagcctgttttggaagccaaaaccaccgtagtgaggcttgataaaaactatc |
23178268 |
T |
 |
| Q |
155 |
gtcctgttcgaatttcagaagatatgaagtctaaaatttttaaatatatt |
204 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23178269 |
gtcctcttcgaatttcagaagatatgaagtctaaaatttttaaatgtatt |
23178318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 98 - 205
Target Start/End: Original strand, 23223552 - 23223659
Alignment:
| Q |
98 |
aatgacagcctgttttggaagccaaaatcaccgtagtgaggcttgataaaaactatcgtcctgttcgaatttcagaagatatgaagtctaaaatttttaa |
197 |
Q |
| |
|
||||||||||| ||||||||||||| ||| | |||| ||||||| ||||||||||||||| |||||||| | | |||||| ||||||||| || |||| |
|
|
| T |
23223552 |
aatgacagcctattttggaagccaaggccacagcagtgtggcttgacaaaaactatcgtcctattcgaattccggcagatattaagtctaaatttgttaa |
23223651 |
T |
 |
| Q |
198 |
atatattc |
205 |
Q |
| |
|
|| ||||| |
|
|
| T |
23223652 |
atttattc |
23223659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University