View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7064_low_1 (Length: 393)
Name: NF7064_low_1
Description: NF7064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7064_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 10 - 380
Target Start/End: Complemental strand, 14776846 - 14776476
Alignment:
| Q |
10 |
agaacctgtgaccctgctccttctgccccatccagtcacaatatctatccggttagggctaacaccagataccagcatctctttgcgaaaccaagcaagt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14776846 |
agaacctgtgaccctgctccttctgccccatccagtcacaatatctatccggttagggctaacaccagataccagcatctctttgcgaaaccaagcaagt |
14776747 |
T |
|
| Q |
110 |
gtcctagacaatgcagttacggctgttccatcagacatgacatgaagatttataagccagtaacagcggcttttctccttcacagcatctggatatacat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14776746 |
gtcctagacaatgcagttacggctgttccatcagacatgacatgaagatttattagccagtaacagcggcttttctccttcacagcatctggatatacat |
14776647 |
T |
|
| Q |
210 |
ttctttgtgcagccacctcccaaaccgaaccagcttcctctttgagcccggacttgtgaagaaaatccaccactgcatctacaagtcctcgtttgccctc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14776646 |
ttctttgtgcagccacctcccaaaccgaaccagcttcctctttgagcccggacttgtgaagaaaatccaccactgcatctacaagtcctcgtttgccctc |
14776547 |
T |
|
| Q |
310 |
tctatcctctgaatgcatcaggtccaaaaatttgcttgcgtgatccctcacattctgaccgtcgggccctg |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14776546 |
tctatcctctgaatgcatcaggtccaaaaatttgcttgcgtgatccctcacattctgaccgtcgggccctg |
14776476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University