View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7064_low_11 (Length: 236)
Name: NF7064_low_11
Description: NF7064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7064_low_11 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0028 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 23 - 218
Target Start/End: Complemental strand, 118260 - 118065
Alignment:
| Q |
23 |
acagacatgtcatagaattggtagcatgttaccaattgaaggagaacaaccaaagtatgcccaactttacatatatgacactgagaatgagatacaaaac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
118260 |
acagacatgtcatagaattggtagcatgttaccaattgaaggagaacaaccaaagtatgcccaactttacatatatgacactgagaatgagatacaaaac |
118161 |
T |
 |
| Q |
123 |
agaattagaggattcgggtacatatttttcaaaccttacgtcaattaactctttacataatcatttcatctataatcatattaattataacttata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
118160 |
agaattagaggattcgggtacatatttttcaaaccttacgtcaattaactctttacataatcatttcatctataatcatattaattataatttata |
118065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 149
Target Start/End: Complemental strand, 22072171 - 22072085
Alignment:
| Q |
63 |
ggagaacaaccaaagtatgcccaactttacatatatgacactgagaatgagatacaaaacagaattagaggattcgggtacatattt |
149 |
Q |
| |
|
||||||| ||| || ||||| |||||||||||||||||||| |||||||||||||| |||| ||||| |||||||| ||| |||||| |
|
|
| T |
22072171 |
ggagaactacctaaatatgctcaactttacatatatgacacagagaatgagatacagaacaaaattaaaggattcgagtatatattt |
22072085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University