View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7064_low_15 (Length: 209)
Name: NF7064_low_15
Description: NF7064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7064_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 38896195 - 38896002
Alignment:
| Q |
1 |
actactctgatcaataattatcgatatcatgtttgaaggacatctttgctgctgccacttcctaataacatttttaattatttccctatcatttatatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38896195 |
actactctgatcaataattatcgatatcatgtttgagggacatctttgctgctgccacttcctaataacatttttaattatttccctatcatttatatga |
38896096 |
T |
 |
| Q |
101 |
attttcaccttaatgtcttactccgagatgtctttcacctcttgttcttgtgaaggagaagtttaagttggacaattattttactttccctatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38896095 |
attttcaccttaatgtcttactccgagatgtctttcacctcttgttcttgtgaaggagaagtttaagttggacaattattttactttctctatg |
38896002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University