View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7065_high_8 (Length: 244)
Name: NF7065_high_8
Description: NF7065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7065_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 11479515 - 11479293
Alignment:
| Q |
1 |
tttaagtttgttaactcgtctttagactaatgcattgtttggcaaggctgaaccgttagcttatagcagacatcttatagcatataagctcatataatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11479515 |
tttaagtttgttaactcgtctttagactaatgcattgtttggcaaggctgaaccgttagcttatagcagacatcttatagcatataagctcatataatca |
11479416 |
T |
 |
| Q |
101 |
aagtagaactatttgataacagttttctcttaagagcttatagcgttttttcacaaacttataccgtttttgagctacaacttcaatatgcttgcttatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11479415 |
aagtagaactatttgataacagttttctcttaagagcttatagcgttttttcacaaacttataccgtttttgagctacaacttcaatatgcttgcttatc |
11479316 |
T |
 |
| Q |
201 |
tgctgtcagttataagttcgtct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11479315 |
tgctgtcagttataagttcgtct |
11479293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 61 - 107
Target Start/End: Complemental strand, 6036133 - 6036087
Alignment:
| Q |
61 |
ttatagcagacatcttatagcatataagctcatataatcaaagtaga |
107 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| |||||||||| |
|
|
| T |
6036133 |
ttatagcagacctcttataacatataagctcatatagtcaaagtaga |
6036087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University