View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7065_low_8 (Length: 306)
Name: NF7065_low_8
Description: NF7065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7065_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 13 - 292
Target Start/End: Complemental strand, 482583 - 482305
Alignment:
| Q |
13 |
aatatatgagccatttgcatcgttatcagtgtcaatattttgacttctgttttatgaatatataattgaaacatgttatccaaaaagaaaggggatttta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
482583 |
aatatatgagccatttgcatcgttatcagtgtcaatattttgacttctgttttatgaatatataattgaaacatat-atccaaaaagaaaggggatttta |
482485 |
T |
 |
| Q |
113 |
ttttaatgaacaatttgaatgattgtgtatttataaaatttaaatatgagcatgaatctggtaaggaatttactcaggttgaaggcttggcaaaacattt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
482484 |
ttttaatgaacaatttgaatgattgtgtatttataaaatttaaatatgagcatgaatctggtaaggaatttactcaggttgaaggcttggcaaaacattt |
482385 |
T |
 |
| Q |
213 |
acgttgtgttgggatagatgctgcagttccttcttcaaagaagcctgaaccaaggtaataatagagtatgcttctgatgt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
482384 |
acgttgtgttgggatagatgctgcagttccttcttcaaagaagcctgaaccaaggtaataatagagtatgcttctgatgt |
482305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University