View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7065_low_9 (Length: 293)
Name: NF7065_low_9
Description: NF7065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7065_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 125 - 275
Target Start/End: Original strand, 31058191 - 31058343
Alignment:
| Q |
125 |
ttccaaagtgattaacttccgatttctactcaaaagttgcttctacacgaagcagaaggttgcgaaaaatggagactgggatagattcatgg--atatac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
31058191 |
ttccaaagtgattaacttccgatttctactcaaaagttgcttctacacgaagcaaaaggttgcgaaaaatggagactgggatacattcatggatatatac |
31058290 |
T |
 |
| Q |
223 |
tagttctaataatttttaggattgtcttaattcttgatattgaatattacttt |
275 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31058291 |
tagttctaataattttgaggattgtcttaattcttgatattgaatattacttt |
31058343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 31058042 - 31058081
Alignment:
| Q |
13 |
aatatgagtcactgcctaacattgtaagtgtttagaatat |
52 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31058042 |
aatatgagccactgcctaacattgtaagtgtttagaatat |
31058081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University