View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7066_high_11 (Length: 278)
Name: NF7066_high_11
Description: NF7066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7066_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 44603786 - 44603520
Alignment:
| Q |
1 |
aggtgtacatatatacaatccttacatttgaaaatt----catgatgttggttaatatgtccacatccattaataaaagtatgatacaataatttgcagg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44603786 |
aggtgtacatatatacaatccttacatttgaaaattaattcatgatgttggttaatatgtccacatccattaataaaagtatgatacaataatttgcagg |
44603687 |
T |
 |
| Q |
97 |
cacgaaagatgcaagagaaaggttggaaaccaaggtggtttgccaaagaagaagggagtaatagttatcgttatgttggtggatattgggagactagaga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44603686 |
cacgaaagatgcaagagaaaggttggaaaccaaggtggtttgccaaagaagaagggagtaatagttatcgttatgttggtggatattgggagactagaga |
44603587 |
T |
 |
| Q |
197 |
aaagggaaaatgggaatctagtcctgatatttttggtcaattttctgctgatcctgatcaagaatct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44603586 |
aaagggaaaatgggaatctagtcctgatatttttggtcaattttctgctgatcctgatcaagaatct |
44603520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University