View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7066_high_15 (Length: 234)
Name: NF7066_high_15
Description: NF7066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7066_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 37111984 - 37112200
Alignment:
| Q |
1 |
gaaaatagaatagaatgttgtgttctgagctctaacttgctatctcagctgctacttcttcttccaaagttgcagcaaaaccatttatgtgccttgtgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111984 |
gaaaatagaatagaatgttgtgttctgagctctaacttgctatctcagctgctacttcttcttccaaagttgcagcaaaaccatttatgtgccttgtgta |
37112083 |
T |
 |
| Q |
101 |
tgagtaaaatatcgattcttttgctgttttagaactac----atgaaagaaaattcaatcatnnnnnnnnnnnncaaaatttagattttgagttgatcat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37112084 |
cgagtaaaatatcgattcttttgctgttttagaactacatgaatgaaagaaaattcaatcat---aaaaataaacaaaatttagattttgagttgatcat |
37112180 |
T |
 |
| Q |
197 |
gtgttacttcataattatat |
216 |
Q |
| |
|
||||||||| || ||||||| |
|
|
| T |
37112181 |
gtgttacttaattattatat |
37112200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University