View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7067_high_5 (Length: 400)
Name: NF7067_high_5
Description: NF7067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7067_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 1685010 - 1685228
Alignment:
| Q |
18 |
ctttctttgtatctgtttcatgcaaagcaaactcgtaacattcatctactttttataaacttaaaaaatcttgatacccttttgtgataatcgattggta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1685010 |
ctttctttgtatctgtttcatgcaaagcaaaatcgtaacattcatctactttttataaacttaaaaaatcttgatacccttttgtgataatcgattggta |
1685109 |
T |
|
| Q |
118 |
tcgtaattaaaggtgcaaacaaaccctgttgtttatgcataactagtgcaaaaaatctgaannnnnnnnnnnnagtcatagtttttgggtgccgcatagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1685110 |
tcgtaattaaaggtgcaaacaaaccctgttgtttatgcataactagtgcaaaaaatctgaattttttatttttagtcatagtttttgggtgccgcatagg |
1685209 |
T |
|
| Q |
218 |
gtttgttactctcctccat |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1685210 |
gtttgttactctcctccat |
1685228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 54 - 117
Target Start/End: Original strand, 44923296 - 44923359
Alignment:
| Q |
54 |
aacattcatctactttttataaacttaaaaaatcttgatacccttttgtgataatcgattggta |
117 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| |||||||||||||| | |||||||||||| |
|
|
| T |
44923296 |
aacattcatctactttctataaacttcaaaaatattgatacccttttgctagaatcgattggta |
44923359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University