View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7067_high_7 (Length: 273)
Name: NF7067_high_7
Description: NF7067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7067_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 41854920 - 41854667
Alignment:
| Q |
18 |
gaaacatcatggcatcaacaataactcgaccgcacattcttcttctgcattcttcatctccatcactcaaactcaatctcaaaccatcgtcaccatttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854920 |
gaaacatcatggcatcaacaataactcgaccgcacattctacttctgcactcttcatctccatcactcaaactcaatctcaaaccatcgtcaccatttct |
41854821 |
T |
 |
| Q |
118 |
tcgctaccgcaatctcccaaattcat------------cacgacgtgtcttctgctccaccaattccacatcttcaaaatcccaatccgcttccattgtt |
205 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854820 |
tcgctaccgaaatctcccaaattcatcgcccttcattccacgacgtgtcttctgctccaccaattccacatcttcaaaatcccaatccgcttccattgtt |
41854721 |
T |
 |
| Q |
206 |
aacgatcttctcgattacctcaacgaatcttggactcatttccacgccacaggt |
259 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41854720 |
aacgatcttctcgattaccttaacgaatcttggactcatttccacgccacaggt |
41854667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University