View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7069_high_7 (Length: 236)
Name: NF7069_high_7
Description: NF7069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7069_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 38747744 - 38747948
Alignment:
| Q |
18 |
gaaccgtcattgaaattcatcccttcaaaagaacccaaaagatcaataagcatgtctctataacgaagattgttactattaatcgaagaaccatagcgtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
38747744 |
gaaccgtcattgaaattcatcccttcaaaagaacccaaaagatcaataagcatgtctctataacgaagattgttactattaattgaagaaccgtagcgtg |
38747843 |
T |
 |
| Q |
118 |
aaagcgatgaaacaccgtttcgtggcttcatcggagacataggtggtgatgccggaggtgaagaaaaatgagacataccaaaaagtgttgaagttggaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747844 |
aaagcgatgaaacaccgtttcgtggcttcatcggagacataggtggtgatgccggaggtgaagaaaaatgagacataccaaaaagtgttgaagttggaga |
38747943 |
T |
 |
| Q |
218 |
attat |
222 |
Q |
| |
|
||||| |
|
|
| T |
38747944 |
attat |
38747948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University