View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7070_low_6 (Length: 203)
Name: NF7070_low_6
Description: NF7070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7070_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 18 - 123
Target Start/End: Complemental strand, 4955621 - 4955516
Alignment:
| Q |
18 |
gtttgattcgcagcactgtaaataaaaaggggtattctctaatgtttattgattgaaatgaaaattgacaacgtgaataaacaaatcctaaatttgttgc |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4955621 |
gtttgattcgcagcactgtaaattaaaaggggtattctctaatgtttattgattgaaatgaaaattgacaacgtgaataaacaaatcctaaatttgttgc |
4955522 |
T |
|
| Q |
118 |
aaataa |
123 |
Q |
| |
|
|||||| |
|
|
| T |
4955521 |
aaataa |
4955516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University