View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7071_high_5 (Length: 275)
Name: NF7071_high_5
Description: NF7071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7071_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 12065245 - 12065491
Alignment:
| Q |
19 |
aatacatgccgaccagaaaatatatttcagcaaaagtataatgtgagtgatcattgcaactatggcaaatgaataatgtaactgctctctctttctacta |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12065245 |
aatacatgccgaccggaaaatatatttcagcaaaagtataatgtgagtgatcattgcaactatggcaaatgaataatgtaactactctctctttctacta |
12065344 |
T |
 |
| Q |
119 |
gcccgtaaacttgatatgtataacaaccttgtgtttcatactttttcataattaaatatatatgactctctctttctcatgttataaagtttatctttta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12065345 |
gcccgtaaacttgatatgtataacaaccttgtgtttcatactttttcataattaaatatatatgactctctctttctcatgttataaagtttatctttta |
12065444 |
T |
 |
| Q |
219 |
tgaaattgggttagtagcagcgctctttctcttatattcatctcact |
265 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
12065445 |
tgaaattgggttagtagcagtgctctttctcttatattcatttcact |
12065491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 32 - 97
Target Start/End: Complemental strand, 12101862 - 12101799
Alignment:
| Q |
32 |
cagaaaatatatttcagcaaaagtataatgtgagtgatcattgcaactatggcaaatgaataatgt |
97 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
12101862 |
cagaaaaaatatttcagcaaaagta--atgtgagtgatcattgacactatggcaagtgaataatgt |
12101799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University