View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7071_high_6 (Length: 214)
Name: NF7071_high_6
Description: NF7071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7071_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 45810106 - 45809920
Alignment:
| Q |
20 |
aaatccttatttggcaagtcaccgataggattcacagtttcaaaaatatgctgtttgatgaaaatttctgtctgccacattcttatgttgagaaattagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45810106 |
aaatccttatttggcaagtcaccgataggattcacagtttcaaaaatatgctgtttgatgaaaacttctgtctgccacattcttatgttgagaaattagg |
45810007 |
T |
 |
| Q |
120 |
aattgaatatggtgatccactacttctgctgattcatacaaaaggtagatatataataacatctttattacaacgcacaggttctgc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45810006 |
aattgaatatggtgatccactacttctgctgattcatacaaaaggtagatatataataacatctttattacaacgcactagttctgc |
45809920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University