View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7071_low_4 (Length: 327)
Name: NF7071_low_4
Description: NF7071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7071_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 11 - 327
Target Start/End: Original strand, 45809295 - 45809611
Alignment:
| Q |
11 |
cagagacaggtagtaagtaacaaacgcatccnnnnnnngcaaccagacaaatgtggtccgtctgatttttggcttattctattaatgatgaaattatttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45809295 |
cagagacaggtagtaagtaacaaacgcatccaaaaaaagcaaccagacaaatgtggtccgtctgatttttggcttattctattaatgatgaaattatttg |
45809394 |
T |
 |
| Q |
111 |
agttaagtggttgttgggtgaataagctttatagtcttgtttgacgttttgccttgccaagattgtgattgttttggacaacaatatatgaatgatgttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45809395 |
agttaagtggttgttgggtgaataagctttatagtcttgtttgacgttttgccttgccaagattgtgattgttttggacaacaatatatgaatgatgttc |
45809494 |
T |
 |
| Q |
211 |
tggtttgtatgcatgtattattattatccaacatgtcatgcattctatgagatttggtattatttgtagctcatagcataaagaaaattttctcaaactt |
310 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45809495 |
tggtttgtatgtatgtattattattatccaacatgtcatgcattctatgagatttggtattatttgtagctcatagcatgaagaaaattttctcaaactt |
45809594 |
T |
 |
| Q |
311 |
ttgtttctttgcctatc |
327 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
45809595 |
ttgttcctttgcctatc |
45809611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University