View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7072_low_18 (Length: 203)
Name: NF7072_low_18
Description: NF7072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7072_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 14 - 167
Target Start/End: Complemental strand, 38089250 - 38089094
Alignment:
| Q |
14 |
gagaagaaagtttttctattggagatgcggattagggagaaagttttcc-gtaggtgtttttgaggtggagattgggatcatactcgtcaacccg--tgc |
110 |
Q |
| |
|
||||||| ||||||||| |||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38089250 |
gagaagagagtttttcttgtggagatgcgtatgagggagaaagttttcccgtaggtgtttttgaggtggagattgggatcatactcgtcaacccgcgtgc |
38089151 |
T |
 |
| Q |
111 |
gacctatctctaagtttattaaaataatatcatatgttgagatattcttgcatcaac |
167 |
Q |
| |
|
||||| || ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38089150 |
gacctgtccctaagtttattaaaataatattatatgttgagatattcttgcatcaac |
38089094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University