View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7072_low_9 (Length: 330)
Name: NF7072_low_9
Description: NF7072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7072_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 43303671 - 43303991
Alignment:
| Q |
1 |
aattgtcagatatgatcacaggtacgcactcgtaaaatatggcttcaactacccgtgggctattgacttcataccctttggggcatatgcagtatttgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43303671 |
aattgtcagatatgatcacaggtacgcactcgtaaaatatggcttcaactacccgtgggctgttgacttcataccctttggggcatatgcagtatttgct |
43303770 |
T |
|
| Q |
101 |
actcttcatgtgttcgatgtaattcattttgtgtgcaacgccatgaggcattgggccaaatatcttcatatcagggtctttctccttccaatgctttagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43303771 |
actcttcatgtgttcgatgtaattcattttgtgtgcaacgccatgaggcattgggccaaatatcttcatatcagggtctttctccttccaatgctttagt |
43303870 |
T |
|
| Q |
201 |
aatatcgaacgcaaatagccatgcatgtttccagcatagaaggccagaatggacctttgttgcggaggttttccgcctagatctctctgaggatttcgta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43303871 |
aatatcgaacgcaaatagccatgcatgtttccagcatagaaggccagaatggacctttgttgcggaggttttccgcctagatctctctgaggatttcgta |
43303970 |
T |
|
| Q |
301 |
ctgaccggaccacaggttctg |
321 |
Q |
| |
|
|||||||||||| || ||||| |
|
|
| T |
43303971 |
ctgaccggaccatagtttctg |
43303991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University