View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7073_high_26 (Length: 221)
Name: NF7073_high_26
Description: NF7073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7073_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 206
Target Start/End: Complemental strand, 47213829 - 47213634
Alignment:
| Q |
11 |
gagatgaaagagaggccaagcggtgcttatggcatgacagttgcagctgttgtaatatgtggtttagcagatggcttggttggtggaagtttgataggat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47213829 |
gagatgaaagagaggccaagcggtgcttatggcatgacagttgcagctgttgtaatatgtggtttagcagatggcttggttggtggaagtttgataggat |
47213730 |
T |
|
| Q |
111 |
cagcaggaaggcttccaaaacagtatatgcaagctgtttttgctggaactgcttcctcaggtaaaattacaagacaattattatatatgttccctc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47213729 |
cagcaggaaggcttccaaaacagtatatgcaagctgtttttgctggaactgcttcctcaggtaaaattacaagacaattattatatatgttccctc |
47213634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University