View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7073_low_12 (Length: 457)
Name: NF7073_low_12
Description: NF7073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7073_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 398; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 398; E-Value: 0
Query Start/End: Original strand, 16 - 446
Target Start/End: Complemental strand, 34439557 - 34439125
Alignment:
| Q |
16 |
cagaatattaccgatggcggccacattgtcctcattttccgatgatctccactcaccgatcatgtcaccgccatccaaaaaggtgggaacggaaaagatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
34439557 |
cagaatattaccgatggcggccacattgtcctcattttccgatgatctccactcaccgatcatgtcaccgccgtccaaaaaggcgggaacggaaaagatc |
34439458 |
T |
 |
| Q |
116 |
tgcatcgatgagatgcttgaaaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcacatat--tgcttgggctttggaagcttttc |
213 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
34439457 |
tgcatcgatgagatgcttgagaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcacatgtcttgcttgggcgttggaagcttttc |
34439358 |
T |
 |
| Q |
214 |
atactatggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttcagccgatggaagtgtctgcgatatggcgtcgtc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34439357 |
atactatggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttccgccgatggaagtgtctgcgatatggcgtcgtc |
34439258 |
T |
 |
| Q |
314 |
gtcgtgggagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaagctgttttc |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34439257 |
gtcgtgggagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaagctgttttc |
34439158 |
T |
 |
| Q |
414 |
tttactggttgtatgattggttcgttcattctt |
446 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34439157 |
tttactggttgtatgattggttcgttcattctt |
34439125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 107 - 441
Target Start/End: Complemental strand, 34422608 - 34422272
Alignment:
| Q |
107 |
gaaaagatctgcatcgatgagatgcttgaaaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcaca--tattgcttgggctttgg |
204 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||| |
|
|
| T |
34422608 |
gaaaaaatctgcatcgatgagatgcttgagaaatactgtggtgagtttggaaaatggcagctgaaacacttcattctcacaagtcttgcttgggcgttgg |
34422509 |
T |
 |
| Q |
205 |
aagcttttcatactatggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttcagccgatggaagtgtctgcgatat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
34422508 |
aagcttttcatactatggttatgatttttgctgatagggaacctgattggaagtgtgttgaaggtatggagtgttccgccaatggaagtgtctgcgatat |
34422409 |
T |
 |
| Q |
305 |
ggcgtcgtcgtcgtgggagtggatcggagggaaagatgcttctacggtgactgagtggagtttgatatgtggtgacaagtttaaagttggacttgttcaa |
404 |
Q |
| |
|
||| |||||||||||| ||||| | | || ||| ||||||||||||| |||| ||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
34422408 |
ggcatcgtcgtcgtggcagtgggttgctggtgaaggtgcttctacggtgtctgaatggagtttgatttgtggtgataagtttaagattggacttgttcaa |
34422309 |
T |
 |
| Q |
405 |
gctgttttctttactggttgtatgattggttcgttca |
441 |
Q |
| |
|
||| |||||||| |||| ||||||||||||| ||||| |
|
|
| T |
34422308 |
gctcttttctttgctgggtgtatgattggttagttca |
34422272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University