View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7073_low_19 (Length: 378)
Name: NF7073_low_19
Description: NF7073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7073_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 20 - 366
Target Start/End: Original strand, 13983155 - 13983502
Alignment:
| Q |
20 |
agaagagagtctcttgattggatttggaaggttggttttttgttttaattcagttctgaccataaagttcttattttcattgaagggtcatgnnnnnnnn |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13983155 |
agaagagaggctcttgattggatttggaaggttggttttttgttttaattcagttctgatcataaagttcttattttcattgaagggtcatgaaaaaaaa |
13983254 |
T |
 |
| Q |
120 |
tcatttttatatgannnnnnngctttaatgtttatgtgattcttaactaagtgtggtttaagtgattctaatatgaatttaatcatcaaaagtgtgtttt |
219 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13983255 |
tcatttttatatgatttttttgctttaatgtttacgtgattcttaactaagtgtggtttaagtgattctaatatgaatttaatcatcaaaagtgtgtttt |
13983354 |
T |
 |
| Q |
220 |
-ttatgtggttttagattgtgactttaatatcaaaatcaattagtatgcaatgtctggtttttcactgaggtttaattggatttccagtgaatttgcttg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13983355 |
tttatgtggttttagattgtgactttaatatcaaaatcaattagtatgcaatgtctggtttttcgctgaggtttaattggattttcagtgaatttgcttg |
13983454 |
T |
 |
| Q |
319 |
ctcaactaattctgtggcaacttgttaaagttcttaattgatgtccat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13983455 |
ctcaactaattctgtggcaacttgttaaagttcttaattgatttccat |
13983502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University