View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7073_low_22 (Length: 366)
Name: NF7073_low_22
Description: NF7073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7073_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Complemental strand, 29788454 - 29788105
Alignment:
| Q |
1 |
ggagggaagatgttgatgaggggaagatggctctcgttcgtcagaaattcattgaagcaaaatatctgtcaacagatgagacgctgcgccaatcgaagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29788454 |
ggagggaagatgttgatgaggggaagatggctctcgttcgtcagaaattcattgaagcaaaatatctgtcaacagatgagacgctgcgccaatcgaagca |
29788355 |
T |
|
| Q |
101 |
atttgaagatgcattggatattttaagctcaaacaatgaactcttggtcaggtttctagattcacaaaatatttatcaaattccctctactccacaggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29788354 |
atttgaagatgcattggatattttaagctcaaacaatgaactcttggtcaggtttctagattcacaaaatatttatcaaattccctctactccacaggat |
29788255 |
T |
|
| Q |
201 |
gatgcaaatcacattactcttatcaaacctatgaagatgtttggcaatgataaatcttctggaaagggtaagaagaaggataggttgattaagaaaccag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29788254 |
gatgcaaatcacattactcttatcaaacctttgaagatgtttggcaatgacaagtcttctggaaagggtaagaagaaggataggttgattaagaaaccag |
29788155 |
T |
|
| Q |
301 |
aaaactatgatcaagcagctgtatgggagaacaggaattatggatactct |
350 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29788154 |
aaaattatgatcaagcagctgtatgggagaacaggaattatggatactct |
29788105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 6 - 130
Target Start/End: Original strand, 39872289 - 39872413
Alignment:
| Q |
6 |
gaagatgttgatgaggggaagatggctctcgttcgtcagaaattcattgaagcaaaatatctgtcaacagatgagacgctgcgccaatcgaagcaatttg |
105 |
Q |
| |
|
||||||||| ||||| |||||||||||| | || || |||||||| |||||||| |||||| |||||||||| | | || ||||||||| | |||| |
|
|
| T |
39872289 |
gaagatgttaatgagaagaagatggctcttatccgccaaaaattcatggaagcaaagcgtctgtctacagatgagaggttacgtcaatcgaaggagtttg |
39872388 |
T |
|
| Q |
106 |
aagatgcattggatattttaagctc |
130 |
Q |
| |
|
| || ||||||| |||||||||| |
|
|
| T |
39872389 |
aggaaacattggaagttttaagctc |
39872413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University