View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7073_low_28 (Length: 287)
Name: NF7073_low_28
Description: NF7073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7073_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 276
Target Start/End: Complemental strand, 39656422 - 39656163
Alignment:
| Q |
16 |
acacgcaccacatacaaaacaacgttcttcatcttcttcctcatgcacggtgcatgatatgtgaaggtgaagtacaccatagcctcatcccatatttatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39656422 |
acacgcaccacatacaaaacaacgttcttcatcttcttcctcatgcacggtgcatgatatgtgaaggt--agtacaccatagcctcatcccatatttatt |
39656325 |
T |
 |
| Q |
116 |
ggattggg-aagatgaagcattctgaacttactaacctgctatttccnnnnnnntaaacaaaatagatgaaagtaattttgaacggaatgtgtttggaac |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39656324 |
ggattggggaagatgaagcattctgaacttactaacctgctatttccaaaaaaataaccaaaataaatgaaagtaattttgaacggaatgtgtttggaac |
39656225 |
T |
 |
| Q |
215 |
tgttaagaaaatttgtgatcatagacatgttttatcttttggtttttccctgttatgttcat |
276 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39656224 |
tgttaagaaaatttgtgatcatatacatgttttatcttgtggtttttccctgttatgttcat |
39656163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University