View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7073_low_41 (Length: 230)
Name: NF7073_low_41
Description: NF7073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7073_low_41 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 230
Target Start/End: Complemental strand, 8193617 - 8193399
Alignment:
| Q |
12 |
cacacacgatttttaactgtaggacctacgacggaagccttcattccaaaagaacaaacacagcacaatgctaacaccaagtaaggtgtgtatagagttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8193617 |
cacacacgatttttaactgtaggacctacgacggaagccttcattccaaaagaacaaacacagcacaatgctaacaccaagtaaggtgtgtatagagttg |
8193518 |
T |
|
| Q |
112 |
agtgaatgggtgactgcaaagcttttatttaagaatgaaaatggagcaccagaatccataatcaaatggggcgcagttagcagcacttttttagtttctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8193517 |
agtgaatgggtgactgcaaagcttttatttaagaatgaaaatggagcaccagaatccataatcaaatggggcgcagttagcagcacttttttagtttctt |
8193418 |
T |
|
| Q |
212 |
ttcatttaataagcttatc |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8193417 |
ttcatttaataagcttatc |
8193399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 220
Target Start/End: Original strand, 38102567 - 38102599
Alignment:
| Q |
188 |
ttagcagcacttttttagtttcttttcatttaa |
220 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
38102567 |
ttagcagcactcttttagtttcttttcatttaa |
38102599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University