View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7074_high_6 (Length: 306)
Name: NF7074_high_6
Description: NF7074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7074_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 281
Target Start/End: Original strand, 26879394 - 26879656
Alignment:
| Q |
19 |
acaatatgagtgaggaattttaacaggatctcagtgatgatccgcgcacatatcagttaggccatttggctctagttcaaggaattaggatagtaggggt |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26879394 |
acaataagagtgaggaattttaacaggatcacagtgatgatccgcgcacatatcagttaggccatttggctctagttcaaggaattagaatagtaggggt |
26879493 |
T |
|
| Q |
119 |
tgtaaatctggaagacagtatccagagggaatgaataacacatcaaacctagaggaaaaattgattgaaattgtatgcttctgaacaacggaaagacata |
218 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26879494 |
tgtaaatctggtagacagtatccagggggaatgaataacacatcaaacctagaggaaaaattgattgaaattgtatgcttctgaacaagggaaagacata |
26879593 |
T |
|
| Q |
219 |
agcacccctaccaaagctctgaacataccgtctgacctagtcccaaaaggattataattacta |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26879594 |
agcacccctaccaaagctctgaacataccgtctgacctagtcccaaaaggattataattacta |
26879656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University