View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7074_high_9 (Length: 241)
Name: NF7074_high_9
Description: NF7074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7074_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 46058185 - 46058398
Alignment:
| Q |
18 |
tatgcaagaaaattaccttgcaaattggattcaggtttgtaagattctgtgcaatgtatgattacgtgatttaatgcgttttgctttgtaagtgagttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46058185 |
tatgcaagaaaattaccttgcaaattggattcaggtttgtaagattctgtgcaatgtatgattacgtgatttaatgtgttttgctttgtaagtgagttaa |
46058284 |
T |
 |
| Q |
118 |
acttatgtgaatttataggcactgtttaattcattgcctccggaggattacaaaaatggagtgttggtgttgggaggtgatggtcgatactttaatagag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46058285 |
acttatgtgaatttataggcactgtttaattcattgcctccggaggattacaaaaatggagtgttggtgttgggaggtgatggtcgatactttaatagag |
46058384 |
T |
 |
| Q |
218 |
aagctacacaggtt |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46058385 |
aagctacacaggtt |
46058398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 27 - 231
Target Start/End: Original strand, 46072510 - 46072714
Alignment:
| Q |
27 |
aaattaccttgcaaattggattcaggtttgtaagattctgtgcaatgtatgattacgtgatttaatgcgttttgctttgtaagtgagttaaacttatgtg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
46072510 |
aaattaccttgcaaattggattcaggtttgtaggattctgtgcaatgtatgattacgcggtttaatgtgttttgctttgtaagtgaattaaacttatgtg |
46072609 |
T |
 |
| Q |
127 |
aatttataggcactgtttaattcattgcctccggaggattacaaaaatggagtgttggtgttgggaggtgatggtcgatactttaatagagaagctacac |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46072610 |
aatttataggcactgtttaattcattgccgccggaggattacaataatggagtgttggtgttgggaggtgatggtcgatactttaatagagaagctgcac |
46072709 |
T |
 |
| Q |
227 |
aggtt |
231 |
Q |
| |
|
||||| |
|
|
| T |
46072710 |
aggtt |
46072714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University