View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7075_high_4 (Length: 403)
Name: NF7075_high_4
Description: NF7075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7075_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 1 - 393
Target Start/End: Complemental strand, 30715673 - 30715281
Alignment:
| Q |
1 |
ttgttgaaacgactcaaatgggttattggggattcgtttggagtgccatgaaaaattggtaaaggagcgattggtatgtatgaagatgcattcatgggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30715673 |
ttgttgaaacgactcaaatgggttattggggattcgtttggagtgccacgaaaaattggtaaaggagcgatttgtatgtatgaagatgcattcatgggtt |
30715574 |
T |
 |
| Q |
101 |
gtgtgggatttgggacattataagaagaaactgaagggctttctggaacattgccaatgtgtgcttcttgtgagaaagatggtttaccatgtggtgcatt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715573 |
gtgtgggatttcggacattataagaagaaactgaagggctttctggaacattgccaatgtgtgcttcttgtgagaaagatggtttaccatgtggtgcatt |
30715474 |
T |
 |
| Q |
201 |
ggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcctctttttcggtttcatcttcaaattgtcggtgttgatcctcttgagattta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
30715473 |
ggacaaggattcagaaacatcatcgtcatcgtcatcattgtcttcttcctcttcttcggtttcatcttcaaactgtcggtgttgatcctcttgagattca |
30715374 |
T |
 |
| Q |
301 |
gaatccacatcgtttgcatcagtactattattatcgttgtcctcgtctttgtattcttctgataacttttgttttggaattctattatgatgt |
393 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30715373 |
gaatccacatcgtctgcatcagtactattattatcgttgtcctcgtctttgtattcttctgataacttttgttttggaattctattatgatgt |
30715281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University