View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7075_low_10 (Length: 284)
Name: NF7075_low_10
Description: NF7075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7075_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 48484022 - 48484292
Alignment:
| Q |
1 |
cttggtgaacagcaacttggcatctgcaaatgaactgcaacttagcactcttgatgcacgtgaagtaattcatttttgatcctttaaagttttgtaaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48484022 |
cttggtgaacagcaacttggcatctgcaaatgaactgcaacttagcactcttgatgcacgtgaagtaattcacgtttgatcctttaaagttttgtaaatc |
48484121 |
T |
 |
| Q |
101 |
agaaagagaatttcaaaatatctgtaataactttacaacttggggatggaaatcatg-acgatgattatagcacctgttacatataataatcttgttatc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484122 |
agaaagagaatttcaaaatatctgtaataactttacaacttggggatggaaatcatgaacgatgattatagcacctgttacatataataatcttgttatc |
48484221 |
T |
 |
| Q |
200 |
ttcccaatcttctacccatctgcaaatcgcacatctctctgttgtccattttgcataaactggttcatatt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484222 |
ttcccaatcttctacccatctgcaaatcgcacatctctctgttgtccattttgcataaactggttcatatt |
48484292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 172 - 268
Target Start/End: Complemental strand, 10036419 - 10036323
Alignment:
| Q |
172 |
acctgttacatataataatcttgttatcttcccaatcttctacccatctgcaaatcgcacatctctctgttgtccattttgcataaactggttcata |
268 |
Q |
| |
|
||||||| || || ||||| |||||||| || | ||||| | |||||| ||||| |||||||| ||||| ||||||||||||| |||||| ||||| |
|
|
| T |
10036419 |
acctgttgcagatgataattttgttatcctcatagtcttcgatccatctacaaatagcacatctttctgtcgtccattttgcatgaactggctcata |
10036323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University