View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7075_low_12 (Length: 260)
Name: NF7075_low_12
Description: NF7075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7075_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 157 - 249
Target Start/End: Complemental strand, 13059346 - 13059254
Alignment:
| Q |
157 |
aaataaatttggagacatgcagccttttatgcacaagcatttgaaatgtaatgtcaaatatctctcctcctataacattctaaccactgatgt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
13059346 |
aaataaatttggagacatgcagccttttatgcacaagcatttgaaatgtaatgtcaaatatctctcctcccataacattctaaccaccgatgt |
13059254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 28 - 140
Target Start/End: Original strand, 24853727 - 24853840
Alignment:
| Q |
28 |
ttgacttcaaacccaaaactaaacatacaatag-ggagtttagatagcctaacaaccccatcttcttaagttcaagtccatctaatgttgtaaatctatg |
126 |
Q |
| |
|
|||| ||||||||||||||||| | |||||| |||||| || ||| ||||||||| | | ||||||||| ||||||| ||||||| | ||| |||| |
|
|
| T |
24853727 |
ttgagttcaaacccaaaactaagaaggcaatagaggagttcaggaagcttaacaacccaaccctcttaagtttaagtccaactaatgtcgcaaacctatt |
24853826 |
T |
 |
| Q |
127 |
gcaaataagactca |
140 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24853827 |
gcaaataagactca |
24853840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University